Pierwszy_projekt

Last updated: March 24th, 20202020-03-24Project preview
In [1]:
print('hello world!')
hello world!
In [2]:
print(witaj świecie!)
  File "<ipython-input-2-fc71fd1b5a31>", line 1
    print(witaj świecie!)
                      ^
SyntaxError: invalid syntax
In [6]:
print ("witaj świecie!")
witaj świecie!
print (123)
In [5]:
print (2+2)
4
In [7]:
print ("2+2")
2+2
In [8]:
# tu może być zupełnie cokolwiekoinffoaidenfoaun3i
In [9]:
print ('blablabla') # print (123123)
blablabla
In [10]:
2+2
Out[10]:
4
In [11]:
2+2
6+13
Out[11]:
19
In [12]:
print (2+2)
print (6+13)
4
19
In [13]:
2-2
Out[13]:
0
In [14]:
2*2
Out[14]:
4
In [15]:
2*123
Out[15]:
246
In [16]:
13/5
Out[16]:
2.6
In [17]:
2,6*5
Out[17]:
(2, 30)
In [18]:
2.6*5
Out[18]:
13.0
In [19]:
2**8
Out[19]:
256
In [20]:
10**3
Out[20]:
1000
In [21]:
10**100
Out[21]:
10000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000000
In [22]:
4**(1/2)
Out[22]:
2.0
In [23]:
10%3
Out[23]:
1
In [24]:
10%4
Out[24]:
2
In [25]:
10%5
Out[25]:
0
In [26]:
10//4
Out[26]:
2
In [27]:
imie = 'krzysztof'
In [28]:
wiek = 33
In [29]:
imie
Out[29]:
'krzysztof'
In [30]:
wiek
Out[30]:
33
In [31]:
wiek*2
Out[31]:
66
In [32]:
imie*2
Out[32]:
'krzysztofkrzysztof'
In [33]:
'ATCG'*2**2
Out[33]:
'ATCGATCGATCGATCG'
In [34]:
'ATCG'*20**2
Out[34]:
'ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG'
In [35]:
'ATCG'*10**3
Out[35]:
'ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG'
In [36]:
wiek*2
Out[36]:
66
In [37]:
33*2
Out[37]:
66
In [38]:
'krzysztof'*2
Out[38]:
'krzysztofkrzysztof'
In [39]:
'krzysztof'*'inny napis'
---------------------------------------------------------------------------
TypeError                                 Traceback (most recent call last)
<ipython-input-39-c291288f3200> in <module>
----> 1 'krzysztof'*'inny napis'

TypeError: can't multiply sequence by non-int of type 'str'
In [40]:
wiek = 33
wiek = wiek+1
print(wiek)
34
In [41]:
wiek = 33
wiek = wiek+1
pint(wiek)
---------------------------------------------------------------------------
NameError                                 Traceback (most recent call last)
<ipython-input-41-9bbccc8b40fe> in <module>
      1 wiek = 33
      2 wiek = wiek+1
----> 3 pint(wiek)

NameError: name 'pint' is not defined
In [42]:
wiek = 33
wiek wiek + 1
print (wiek)
  File "<ipython-input-42-15dd096f6e8e>", line 2
    wiek wiek + 1
            ^
SyntaxError: invalid syntax
In [45]:
wiek = 33
wiek = wiek+1
print(wiek)
34
In [49]:
wiek = wiek+1
print(wiek)
38
In [50]:
imie = 'krzysztof'
In [51]:
type(imie)
Out[51]:
str
In [52]:
wiek = 33
type(wiek)
Out[52]:
int
In [53]:
wiek = 32.5
type(wiek)
Out[53]:
float
In [54]:
11**1000*11*10000
Out[54]:
271692620980640896753649722359374362548070672376223585835610124701381332941297649290465272810264081117118391730794017569988717859922810985736817192109032081042200239365994065519126306779853293162207438700017035233326975903844932529911553981206234489868473709794999516706102009397972780194016454517763540625009461705930462871963218289567693896610601392655858474702539020200530256276842708595265874336920465202276934942597353070388453824397025347286082054511313004636368572206891357264094402890144828039037778081950537863949014718957298375528263876140281014412988882673875817992367483808205241106454663600743158992608450886360767384893229383255035835282300995796875301570643610940014979509365988403720022384562877642070148421228467149558400091397983014778766577412173360580998234835791416700427367698263234029389178892906196212316239756948447550758908099210791358466279159453978616070211408664028114695299722395934757299783765330870133653612382280262364932442752978805296950852424395323011059936756881068373374912184268416089979655564613290600110000
In [59]:
wiek = 18 + 5 + 2 + 4 + 3
In [60]:
wiek
Out[60]:
32
In [62]:
'mój wiek to ' + str(wiek)
Out[62]:
'mój wiek to 32'
In [63]:
'33' + '23'
Out[63]:
'3323'
In [64]:
int('23') + int('23')
Out[64]:
46
In [65]:
int(wiek) + 23
Out[65]:
55
In [ ]:
 
Notebooks AI
Notebooks AI Profile20060